J Cancer 2024; 15(6):1733. doi:10.7150/jca.93189 This issue Cite

Erratum

FAM72A promotes glioma progression by regulating mitophagy through the Pink1/Parkin signaling pathway: Erratum

Yibin Zeng1, Cui Xiong2, Nan Tang1, Siqi Wang3, Zhiyong Xiong1, Tao Liang4, Qiangping Wang1, Menglong Li5 Corresponding address, Junjun Li1 Corresponding address

1. Department of Neurosurgery, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, 1277 Jiefang Avenue, Wuhan, Hubei, 430022, China.
2. Department of Endocrinology, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, 1277 Jiefang Avenue, Wuhan, Hubei, 430022, China.
3. Department of Radiology, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, 1277 Jiefang Avenue, Wuhan, Hubei, 430022, China.
4. Department of Clinical Laboratory, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, 1277 Jiefang Avenue, Wuhan, Hubei, 430022, China.
5. Department of Neurosurgery, Nanshi Hospital of Nanyang, Henan University, No. 988, Zhongzhou West Road, Nanyang City, 442000, China.

Published 2024-2-1

Citation:
Zeng Y, Xiong C, Tang N, Wang S, Xiong Z, Liang T, Wang Q, Li M, Li J. FAM72A promotes glioma progression by regulating mitophagy through the Pink1/Parkin signaling pathway: Erratum. J Cancer 2024; 15(6):1733. doi:10.7150/jca.93189. https://www.jcancer.org/v15p1733.htm
Other styles

File import instruction

Corrected-article in J Cancer, Volume 14, 903

 

In the original version of our article, there were three errors in the Supplementary Table 3, Supplementary Table 4 and Supplementary Table 5. Specifically, the siRNA sequence information in Supplementary Table 3 was wrong, the correct siRNA sequence is provided below: siFAM72A-1: GTACAGATGAAGATGTGTTAA and siFAM72A-2: GCTCAGCATGATGTTAGATAA.

The antibody number in Supplementary Table 4 was wrong, the correct numbers were nbp2-59790(Novus, Colorado, USA) and orb863765 (Cambridge, United Kingdom). In addition, the FAM72A primers (human) in Supplementary Table 5 was missed, in fact, we also detected Fam72a gene expression in mouse brain tumors and normal brain tissues in the previous experiment (results not shown in the article), but only mouse primers were provided in the supplementary materials, and we made the following supplements: human FAM72A qPCR primers: F: GGAATGAAGGCTGTTTTGCTGGC; R: AACATGCGATGTCCTTCAGTTTAC. The mouse Gapdh qPCR primers are as follows: F: AGGTCGGTGTGAACGGATTTG; R: GGGGTCGTTGATGGCAACA.

We are truly sorry for these errors. This correction will not affect the results and conclusions. The authors apologize for any inconvenience this may have caused.

Author contact

Corresponding address Corresponding authors: Menglong Li, lml13477303118com and Junjun Li, ljj19891105com


Citation styles

APA
Zeng, Y., Xiong, C., Tang, N., Wang, S., Xiong, Z., Liang, T., Wang, Q., Li, M., Li, J. (2024). FAM72A promotes glioma progression by regulating mitophagy through the Pink1/Parkin signaling pathway: Erratum. Journal of Cancer, 15(6), 1733. https://doi.org/10.7150/jca.93189.

ACS
Zeng, Y.; Xiong, C.; Tang, N.; Wang, S.; Xiong, Z.; Liang, T.; Wang, Q.; Li, M.; Li, J. FAM72A promotes glioma progression by regulating mitophagy through the Pink1/Parkin signaling pathway: Erratum. J. Cancer 2024, 15 (6), 1733. DOI: 10.7150/jca.93189.

NLM
Zeng Y, Xiong C, Tang N, Wang S, Xiong Z, Liang T, Wang Q, Li M, Li J. FAM72A promotes glioma progression by regulating mitophagy through the Pink1/Parkin signaling pathway: Erratum. J Cancer 2024; 15(6):1733. doi:10.7150/jca.93189. https://www.jcancer.org/v15p1733.htm

CSE
Zeng Y, Xiong C, Tang N, Wang S, Xiong Z, Liang T, Wang Q, Li M, Li J. 2024. FAM72A promotes glioma progression by regulating mitophagy through the Pink1/Parkin signaling pathway: Erratum. J Cancer. 15(6):1733.

This is an open access article distributed under the terms of the Creative Commons Attribution License (https://creativecommons.org/licenses/by/4.0/). See http://ivyspring.com/terms for full terms and conditions.
Popup Image